Transcript: Human NM_006844.5

Homo sapiens ilvB acetolactate synthase like (ILVBL), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ILVBL (10994)
Length:
2305
CDS:
142..2040

Additional Resources:

NCBI RefSeq record:
NM_006844.5
NBCI Gene record:
ILVBL (10994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006844.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002732 AGTCTCATCATTGCTTGCCCT pLKO.1 2103 3UTR 100% 0.660 0.924 N ILVBL n/a
2 TRCN0000231807 ACGCTACCTGACAACTCAATT pLKO_005 1510 CDS 100% 13.200 10.560 N ILVBL n/a
3 TRCN0000231806 ATCATCATCGTCAATCGTAAT pLKO_005 1249 CDS 100% 10.800 8.640 N ILVBL n/a
4 TRCN0000231805 CGAGTGGTCTCCTGGTATTTA pLKO_005 844 CDS 100% 15.000 10.500 N ILVBL n/a
5 TRCN0000378404 ATGCTGGCTGGACACAGATTT pLKO_005 1784 CDS 100% 13.200 9.240 N ILVBL n/a
6 TRCN0000378464 GCCTGGCCTACACTGATTATC pLKO_005 1847 CDS 100% 13.200 9.240 N ILVBL n/a
7 TRCN0000231808 GCTACAGCCTCATCGAATTTG pLKO_005 1715 CDS 100% 13.200 9.240 N ILVBL n/a
8 TRCN0000002730 CATTGCTGTATAGGGCCTTGT pLKO.1 2028 CDS 100% 4.050 2.835 N ILVBL n/a
9 TRCN0000002731 CCGTCTTTGCTGCTGATGCTA pLKO.1 443 CDS 100% 3.000 2.100 N ILVBL n/a
10 TRCN0000010732 CCTCTTCACGGACCCAACTGT pLKO.1 2222 3UTR 100% 1.000 0.700 N ILVBL n/a
11 TRCN0000002733 TGTGAGAAACTGGGCATCCGT pLKO.1 394 CDS 100% 0.750 0.525 N ILVBL n/a
12 TRCN0000257157 TGGTTTGGAGTCTCATCATTG pLKO_005 2095 3UTR 100% 10.800 6.480 N ILVBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006844.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07720 pDONR223 100% 99.9% 100% None 1035T>C n/a
2 ccsbBroad304_07720 pLX_304 0% 99.9% 100% V5 1035T>C n/a
3 TRCN0000478634 ATATACCACATAAATGTAGTGGCG pLX_317 16.9% 99.9% 100% V5 1035T>C n/a
4 ccsbBroadEn_07721 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
5 ccsbBroad304_07721 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
6 TRCN0000470732 ACCGCTTGCATTTGGGATTTCTGC pLX_317 22.7% 99.7% 99.8% V5 (many diffs) n/a
Download CSV