Transcript: Human NM_006877.4

Homo sapiens guanosine monophosphate reductase (GMPR), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GMPR (2766)
Length:
1508
CDS:
108..1145

Additional Resources:

NCBI RefSeq record:
NM_006877.4
NBCI Gene record:
GMPR (2766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006877.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046459 CAATGGGTATTCAGAACATTT pLKO.1 500 CDS 100% 13.200 10.560 N GMPR n/a
2 TRCN0000046460 CCTTCACGTTTCGAAATTCAA pLKO.1 211 CDS 100% 5.625 4.500 N GMPR n/a
3 TRCN0000046462 GAAATGGTAGAAGAGCTTATT pLKO.1 594 CDS 100% 13.200 9.240 N GMPR n/a
4 TRCN0000046461 ACTGTGGAAGTTCCTTACAAA pLKO.1 981 CDS 100% 5.625 3.938 N GMPR n/a
5 TRCN0000046458 CCATGTTTACAGCAATTCATA pLKO.1 319 CDS 100% 5.625 3.938 N GMPR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006877.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06289 pDONR223 100% 99.9% 99.7% None 766T>A n/a
2 ccsbBroad304_06289 pLX_304 0% 99.9% 99.7% V5 766T>A n/a
3 TRCN0000471850 GGTACATGTACCGTGAATTCCGGT pLX_317 43.4% 99.9% 99.7% V5 766T>A n/a
Download CSV