Transcript: Human NM_006914.4

Homo sapiens RAR related orphan receptor B (RORB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RORB (6096)
Length:
9581
CDS:
643..2022

Additional Resources:

NCBI RefSeq record:
NM_006914.4
NBCI Gene record:
RORB (6096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421952 GCCCAAGTCTGAGGGTTATTA pLKO_005 1089 CDS 100% 15.000 21.000 N RORB n/a
2 TRCN0000414887 GGAGTTTGCAAAGCGGATAAC pLKO_005 1464 CDS 100% 10.800 15.120 N RORB n/a
3 TRCN0000022171 CCGTTATACAAGGAGCTCTTT pLKO.1 1972 CDS 100% 4.950 6.930 N RORB n/a
4 TRCN0000022170 CCGTGCCTTCAACCCATTAAA pLKO.1 1566 CDS 100% 15.000 10.500 N RORB n/a
5 TRCN0000426331 CATGGAATGCATCACCATTAA pLKO_005 2049 3UTR 100% 13.200 9.240 N RORB n/a
6 TRCN0000422403 GAGCGGTACTTTACATGATTA pLKO_005 2343 3UTR 100% 13.200 9.240 N RORB n/a
7 TRCN0000022173 GCAAAGTTAATAGCCAAGATA pLKO.1 1861 CDS 100% 5.625 3.938 N RORB n/a
8 TRCN0000022172 CCCAAGGCAGAGAAACTGTTT pLKO.1 780 CDS 100% 4.950 3.465 N RORB n/a
9 TRCN0000022169 CCCACACCTATGAAGAAATTA pLKO.1 1364 CDS 100% 15.000 9.000 N RORB n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5728 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006914.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491512 CGTTTACCCCCCGCCGCCCACGTC pLX_317 20.7% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488384 TATAAGGCACCCAATAACCGAGAT pLX_317 13.6% 99.9% 99.7% V5 1377_1378insG n/a
Download CSV