Transcript: Human NM_006939.4

Homo sapiens SOS Ras/Rho guanine nucleotide exchange factor 2 (SOS2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SOS2 (6655)
Length:
5508
CDS:
296..4294

Additional Resources:

NCBI RefSeq record:
NM_006939.4
NBCI Gene record:
SOS2 (6655)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006939.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048157 GCTCAGTTCTAGTCAGAATAA pLKO.1 4123 CDS 100% 13.200 18.480 N SOS2 n/a
2 TRCN0000048154 CCAAACATGAACGGCATATTT pLKO.1 1653 CDS 100% 15.000 10.500 N SOS2 n/a
3 TRCN0000418021 CAGTACAACTTAGGATCTTAA pLKO_005 2340 CDS 100% 13.200 9.240 N SOS2 n/a
4 TRCN0000048156 CCTTCGTTGAAGGAAGTATTA pLKO.1 629 CDS 100% 13.200 9.240 N SOS2 n/a
5 TRCN0000425699 GGCTCTACCTCAGGTACTTTA pLKO_005 3431 CDS 100% 13.200 9.240 N SOS2 n/a
6 TRCN0000423883 GGTAGCATGGACCGAATTTAC pLKO_005 1442 CDS 100% 13.200 9.240 N SOS2 n/a
7 TRCN0000048153 GCAGGACATTAAAGTGTCAAT pLKO.1 772 CDS 100% 4.950 3.465 N SOS2 n/a
8 TRCN0000048155 GCTGTGGAATTAAGTCAAGAT pLKO.1 2999 CDS 100% 4.950 3.465 N SOS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006939.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01578 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01578 pLX_304 0% 100% 100% V5 n/a
Download CSV