Transcript: Human NM_006952.4

Homo sapiens uroplakin 1B (UPK1B), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
UPK1B (7348)
Length:
2028
CDS:
70..852

Additional Resources:

NCBI RefSeq record:
NM_006952.4
NBCI Gene record:
UPK1B (7348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135707 GTAGCCTCAATTCTCCATTAA pLKO.1 1448 3UTR 100% 13.200 18.480 N UPK1B n/a
2 TRCN0000136875 CGGAGTGCATCTTCTTTGTAT pLKO.1 161 CDS 100% 5.625 7.875 N UPK1B n/a
3 TRCN0000137479 GCATAAAGTGTTGCCACCATA pLKO.1 853 CDS 100% 4.950 6.930 N UPK1B n/a
4 TRCN0000138357 CCACACTAACGTGTGTGTCTT pLKO.1 943 3UTR 100% 0.495 0.396 N UPK1B n/a
5 TRCN0000136039 GCCTGTATCTCTCACTATTAT pLKO.1 1205 3UTR 100% 15.000 10.500 N UPK1B n/a
6 TRCN0000138867 GCCTCGTCAATGCTGTGTTAT pLKO.1 627 CDS 100% 13.200 9.240 N UPK1B n/a
7 TRCN0000135956 GCTTCTGTTGATCTCAGTATT pLKO.1 1245 3UTR 100% 13.200 9.240 N UPK1B n/a
8 TRCN0000137050 CCTTCCAATGCTTCTGTTGAT pLKO.1 1236 3UTR 100% 4.950 3.465 N UPK1B n/a
9 TRCN0000138431 CCATGTTCTACTGGAGCAGAA pLKO.1 821 CDS 100% 4.050 2.835 N UPK1B n/a
10 TRCN0000135955 GAACCTGTGTTATCACAGTAA pLKO.1 1157 3UTR 100% 0.495 0.347 N UPK1B n/a
11 TRCN0000137375 GCAGCAACACAACAAGACTTT pLKO.1 394 CDS 100% 4.950 2.970 N UPK1B n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1500 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006952.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07116 pDONR223 100% 99.8% 99.6% None 338A>G n/a
Download CSV