Transcript: Human NM_006984.5

Homo sapiens claudin 10 (CLDN10), transcript variant b, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CLDN10 (9071)
Length:
2466
CDS:
35..721

Additional Resources:

NCBI RefSeq record:
NM_006984.5
NBCI Gene record:
CLDN10 (9071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006984.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439099 CAAAGTCGGAGGCTCCGATAA pLKO_005 346 CDS 100% 10.800 15.120 N CLDN10 n/a
2 TRCN0000116566 CGCTCTTTGGAATGAAGTGTA pLKO.1 324 CDS 100% 4.950 6.930 N CLDN10 n/a
3 TRCN0000116562 GCAGCAAGTTATCTGGTAGAA pLKO.1 1262 3UTR 100% 4.950 6.930 N CLDN10 n/a
4 TRCN0000116564 CGGACAAAGTATCATGGTGGA pLKO.1 644 CDS 100% 2.160 3.024 N CLDN10 n/a
5 TRCN0000454963 ATTCATAGATAGAAGTCTTTG pLKO_005 1036 3UTR 100% 10.800 7.560 N CLDN10 n/a
6 TRCN0000116565 CCTGGGCTTCTTTGGTTCCAT pLKO.1 298 CDS 100% 3.000 2.100 N CLDN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006984.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02073 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02073 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465260 CCGTCCAGCCGGTATACATTTAAA pLX_317 48.1% 100% 100% V5 n/a
Download CSV