Transcript: Human NM_007009.3

Homo sapiens zona pellucida binding protein (ZPBP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZPBP (11055)
Length:
1195
CDS:
53..1108

Additional Resources:

NCBI RefSeq record:
NM_007009.3
NBCI Gene record:
ZPBP (11055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136509 CTGAACTGATAGACCCATCAT pLKO.1 330 CDS 100% 4.950 6.930 N ZPBP n/a
2 TRCN0000135650 GTTGGACACTTGGTTCGATTA pLKO.1 179 CDS 100% 10.800 8.640 N ZPBP n/a
3 TRCN0000134336 GTTTGGATTAATCGCTGCTTT pLKO.1 941 CDS 100% 4.950 3.465 N ZPBP n/a
4 TRCN0000133744 CACAAATAACATCCACAGGAA pLKO.1 402 CDS 100% 2.640 1.848 N ZPBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07736 pDONR223 100% 99.8% 99.7% None 12C>T;1048T>A n/a
2 ccsbBroad304_07736 pLX_304 0% 99.8% 99.7% V5 12C>T;1048T>A n/a
3 TRCN0000471387 CGCACTGGGAAAGATAGGCTACGC pLX_317 46% 99.8% 99.7% V5 12C>T;1048T>A n/a
Download CSV