Transcript: Human NM_007024.5

Homo sapiens transmembrane protein 115 (TMEM115), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TMEM115 (11070)
Length:
2107
CDS:
459..1514

Additional Resources:

NCBI RefSeq record:
NM_007024.5
NBCI Gene record:
TMEM115 (11070)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007024.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437118 ACCTGTTCACTGTCCGTATCC pLKO_005 844 CDS 100% 4.050 5.670 N TMEM115 n/a
2 TRCN0000179972 CAGTTGGGTATATCTTCGCTT pLKO.1 1058 CDS 100% 2.640 3.696 N TMEM115 n/a
3 TRCN0000420414 ACGGTGAAGCGCTACGATGTG pLKO_005 1224 CDS 100% 1.350 1.890 N TMEM115 n/a
4 TRCN0000180504 GCCCTCATCTGAGGTAAGAAT pLKO.1 1743 3UTR 100% 5.625 4.500 N TMEM115 n/a
5 TRCN0000147505 GAAGGTAAAGATATGCCAGAA pLKO.1 1202 CDS 100% 4.050 3.240 N TMEM115 n/a
6 TRCN0000180639 CCAACTCCAGACAACCACTAT pLKO.1 1685 3UTR 100% 4.950 3.465 N TMEM115 n/a
7 TRCN0000427375 CCCAGAATCCAGTCTAATCAC pLKO_005 1466 CDS 100% 4.950 3.465 N TMEM115 n/a
8 TRCN0000429422 TTCTTCTCAGTGGTGAATGTG pLKO_005 759 CDS 100% 4.950 3.465 N TMEM115 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007024.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02611 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02611 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468687 ATTCATAACATCGCCTGACCAGTC pLX_317 26.7% 100% 100% V5 n/a
Download CSV