Transcript: Human NM_007149.2

Homo sapiens zinc finger protein 184 (ZNF184), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Homo sapiens (human)
Gene:
ZNF184 (7738)
Length:
3119
CDS:
286..2541

Additional Resources:

NCBI RefSeq record:
NM_007149.2
NBCI Gene record:
ZNF184 (7738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422758 AGTTATCTCTCAAACCTTAAT pLKO_005 1819 CDS 100% 13.200 9.240 N ZNF184 n/a
2 TRCN0000432437 GTTATGGTTCATCCCTTATTC pLKO_005 1988 CDS 100% 13.200 9.240 N ZNF184 n/a
3 TRCN0000107996 CTTGCTAGAAAGTTGGGAATA pLKO.1 702 CDS 100% 10.800 7.560 N ZNF184 n/a
4 TRCN0000432514 TGGTAAAGCCTTTCGACATTG pLKO_005 2142 CDS 100% 10.800 7.560 N ZNF184 n/a
5 TRCN0000096392 CATCTCTTGCTCAACATCAAA pLKO.1 2165 CDS 100% 5.625 3.938 N Zfp184 n/a
6 TRCN0000107997 CCTGATGTGATTTCCCAGTTA pLKO.1 505 CDS 100% 4.950 3.465 N ZNF184 n/a
7 TRCN0000107999 TCGGAGTTCATCTCTTGCTAA pLKO.1 1905 CDS 100% 4.950 3.465 N ZNF184 n/a
8 TRCN0000107998 ACTTGCTAGAAAGTTGGGAAT pLKO.1 701 CDS 100% 4.050 2.835 N ZNF184 n/a
9 TRCN0000417656 GAACGACCTTACAAGTGTAAT pLKO_005 2032 CDS 100% 13.200 7.920 N ZNF184 n/a
10 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 2362 CDS 100% 15.000 7.500 Y Gm10771 n/a
11 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 2362 CDS 100% 15.000 7.500 Y ZNF286B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07170 pDONR223 100% 99.9% 99.8% None 79G>T n/a
2 ccsbBroad304_07170 pLX_304 0% 99.9% 99.8% V5 79G>T n/a
3 TRCN0000467767 CTATGTTCATAGCTAACTCCGTAC pLX_317 20.3% 99.9% 99.8% V5 79G>T n/a
Download CSV