Transcript: Human NM_007183.4

Homo sapiens plakophilin 3 (PKP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PKP3 (11187)
Length:
2817
CDS:
85..2478

Additional Resources:

NCBI RefSeq record:
NM_007183.4
NBCI Gene record:
PKP3 (11187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007183.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123246 CGCTAGGAACAAGGACGAGAT pLKO.1 2139 CDS 100% 4.050 5.670 N PKP3 n/a
2 TRCN0000290193 CGCTAGGAACAAGGACGAGAT pLKO_005 2139 CDS 100% 4.050 5.670 N PKP3 n/a
3 TRCN0000123247 CATCTACGACAACGCTGACAA pLKO.1 1248 CDS 100% 4.950 3.960 N PKP3 n/a
4 TRCN0000290194 CATCTACGACAACGCTGACAA pLKO_005 1248 CDS 100% 4.950 3.960 N PKP3 n/a
5 TRCN0000123245 CCGAAAGCTCATCTTCATCAA pLKO.1 2319 CDS 100% 4.950 3.960 N PKP3 n/a
6 TRCN0000290191 CCGAAAGCTCATCTTCATCAA pLKO_005 2319 CDS 100% 4.950 3.960 N PKP3 n/a
7 TRCN0000123248 CTCAGCAGTCAAGTACCTCAT pLKO.1 1050 CDS 100% 4.050 2.835 N PKP3 n/a
8 TRCN0000290124 CTCAGCAGTCAAGTACCTCAT pLKO_005 1050 CDS 100% 4.050 2.835 N PKP3 n/a
9 TRCN0000123244 CCTGTGTGCATCTTTGAGGGT pLKO.1 2602 3UTR 100% 0.660 0.462 N PKP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007183.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07767 pDONR223 100% 99.8% 100% None (many diffs) n/a
2 ccsbBroad304_07767 pLX_304 0% 99.8% 100% V5 (many diffs) n/a
Download CSV