Transcript: Human NM_007188.5

Homo sapiens ATP binding cassette subfamily B member 8 (ABCB8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ABCB8 (11194)
Length:
4656
CDS:
67..2223

Additional Resources:

NCBI RefSeq record:
NM_007188.5
NBCI Gene record:
ABCB8 (11194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007188.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428942 ACTGACGTGCAGGAGTTTAAG pLKO_005 784 CDS 100% 13.200 18.480 N ABCB8 n/a
2 TRCN0000427213 TGCGTGGCTCCGTTACATTTC pLKO_005 1418 CDS 100% 10.800 15.120 N ABCB8 n/a
3 TRCN0000420718 AGCGAATGCTCACGAGTTCAT pLKO_005 1776 CDS 100% 4.950 3.960 N ABCB8 n/a
4 TRCN0000059874 CTTTGAGTACATGGCCCTGAA pLKO.1 1350 CDS 100% 4.050 3.240 N ABCB8 n/a
5 TRCN0000414567 CCAACCTCTCTGTCCTGTTTG pLKO_005 1292 CDS 100% 10.800 7.560 N ABCB8 n/a
6 TRCN0000059875 TCACCTTCTTTGACGCCAATA pLKO.1 734 CDS 100% 10.800 7.560 N ABCB8 n/a
7 TRCN0000431615 TCATGACTGAGTCCCAGAATC pLKO_005 575 CDS 100% 10.800 7.560 N ABCB8 n/a
8 TRCN0000059877 CGCCTTCAACTGCATGGTCTT pLKO.1 1167 CDS 100% 4.050 2.835 N ABCB8 n/a
9 TRCN0000426374 TTCCGATGAAGAGGTGTACAC pLKO_005 1743 CDS 100% 4.050 2.835 N ABCB8 n/a
10 TRCN0000059873 CCCATGGTACTGAGTAAGCAT pLKO.1 307 CDS 100% 3.000 2.100 N ABCB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007188.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15739 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15739 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_02645 pDONR223 100% 100% 100% None n/a
4 ccsbBroad304_02645 pLX_304 0% 100% 100% V5 n/a
5 TRCN0000475449 CAGCAGCTTTATACTTGAGCCTTC pLX_317 19.6% 100% 100% V5 n/a
Download CSV