Transcript: Human NM_007191.5

Homo sapiens WNT inhibitory factor 1 (WIF1), mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
WIF1 (11197)
Length:
1977
CDS:
115..1254

Additional Resources:

NCBI RefSeq record:
NM_007191.5
NBCI Gene record:
WIF1 (11197)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007191.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373888 ATGTCAATTGATCAGGTTAAA pLKO_005 1489 3UTR 100% 13.200 18.480 N WIF1 n/a
2 TRCN0000033311 GCCAGCTATTCCTGTCAATAT pLKO.1 345 CDS 100% 13.200 18.480 N WIF1 n/a
3 TRCN0000373967 TAAATCACTGAGCTGATATTT pLKO_005 1382 3UTR 100% 15.000 10.500 N WIF1 n/a
4 TRCN0000033309 CCTGTCGAAATGGAGGTAAAT pLKO.1 956 CDS 100% 13.200 9.240 N WIF1 n/a
5 TRCN0000033312 GCAAGAGTACTCATAGGATTT pLKO.1 247 CDS 100% 10.800 7.560 N WIF1 n/a
6 TRCN0000446274 GGGATCCACCTGAATCCAATT pLKO_005 1223 CDS 100% 10.800 7.560 N Wif1 n/a
7 TRCN0000033313 GCATTTGAAGTGGATGTGATT pLKO.1 559 CDS 100% 4.950 3.465 N WIF1 n/a
8 TRCN0000033310 CGATGTATGAATGGTGGACTT pLKO.1 763 CDS 100% 4.050 2.835 N WIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007191.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07769 pDONR223 100% 99.7% 99.7% None 177A>G;219A>G;496C>A n/a
2 ccsbBroad304_07769 pLX_304 0% 99.7% 99.7% V5 177A>G;219A>G;496C>A n/a
3 TRCN0000473849 ACTAGTTACCCCACAGTGTTATTG pLX_317 47.1% 99.7% 99.7% V5 177A>G;219A>G;496C>A n/a
Download CSV