Transcript: Human NM_007193.5

Homo sapiens annexin A10 (ANXA10), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
ANXA10 (11199)
Length:
1441
CDS:
165..1139

Additional Resources:

NCBI RefSeq record:
NM_007193.5
NBCI Gene record:
ANXA10 (11199)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007193.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344925 TACTGTTCATGGCACTATTAA pLKO_005 1213 3UTR 100% 15.000 21.000 N ANXA10 n/a
2 TRCN0000344924 CCCAATTTCAATCCCATAATG pLKO_005 207 CDS 100% 13.200 18.480 N ANXA10 n/a
3 TRCN0000054026 CCCTATTTCATGATATCAGAA pLKO.1 1051 CDS 100% 4.950 6.930 N ANXA10 n/a
4 TRCN0000333580 CCCTATTTCATGATATCAGAA pLKO_005 1051 CDS 100% 4.950 6.930 N ANXA10 n/a
5 TRCN0000054023 GCTGACCATAAGGAAACGATA pLKO.1 1010 CDS 100% 4.950 6.930 N ANXA10 n/a
6 TRCN0000054027 CAAGGATTTGACTGTGACAAA pLKO.1 255 CDS 100% 4.950 3.960 N ANXA10 n/a
7 TRCN0000054025 GCTCCCAATTTCAATCCCATA pLKO.1 204 CDS 100% 4.050 2.835 N ANXA10 n/a
8 TRCN0000054024 GCCTCATTGAAATACTAGCTT pLKO.1 496 CDS 100% 3.000 2.100 N ANXA10 n/a
9 TRCN0000333579 GCCTCATTGAAATACTAGCTT pLKO_005 496 CDS 100% 3.000 2.100 N ANXA10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007193.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02646 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02646 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474748 ACCCATTTAAACCTTCATGAATCA pLX_317 44.2% 100% 100% V5 n/a
Download CSV