Transcript: Human NM_007200.5

Homo sapiens A-kinase anchoring protein 13 (AKAP13), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
AKAP13 (11214)
Length:
13327
CDS:
208..8649

Additional Resources:

NCBI RefSeq record:
NM_007200.5
NBCI Gene record:
AKAP13 (11214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007200.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308040 CCCAATGACCCAGGCGATAAA pLKO_005 4353 CDS 100% 13.200 18.480 N AKAP13 n/a
2 TRCN0000037973 CCTCACCCATTTGTTCTACAA pLKO.1 2153 CDS 100% 4.950 6.930 N AKAP13 n/a
3 TRCN0000037970 CGGAATCAGATAGTGGCCTAA pLKO.1 7694 CDS 100% 4.050 3.240 N AKAP13 n/a
4 TRCN0000296008 GAGTCTTGGAGTCGGATAATA pLKO_005 6127 CDS 100% 15.000 10.500 N AKAP13 n/a
5 TRCN0000296006 TGAGAATGCAGAACGTTTAAA pLKO_005 6468 CDS 100% 15.000 10.500 N AKAP13 n/a
6 TRCN0000296007 CAATAAGCAACAGATGATATT pLKO_005 8792 3UTR 100% 13.200 9.240 N AKAP13 n/a
7 TRCN0000037969 CCTCCAAGAAAGATTCTGAAT pLKO.1 5402 CDS 100% 4.950 3.465 N AKAP13 n/a
8 TRCN0000037972 GCAGTTCTTCTCACTGACATT pLKO.1 6961 CDS 100% 4.950 3.465 N AKAP13 n/a
9 TRCN0000037971 GCTGAAGATGATGTAGTGTTT pLKO.1 283 CDS 100% 4.950 3.465 N AKAP13 n/a
10 TRCN0000298855 GCTGAAGATGATGTAGTGTTT pLKO_005 283 CDS 100% 4.950 3.465 N AKAP13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007200.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11613 pDONR223 100% 6% 5.7% None (many diffs) n/a
2 ccsbBroad304_11613 pLX_304 0% 6% 5.7% V5 (many diffs) n/a
3 TRCN0000469409 TTGTTTTCAGCGAGCACACGTTAG pLX_317 70.5% 6% 5.7% V5 (many diffs) n/a
Download CSV