Transcript: Human NM_007209.4

Homo sapiens ribosomal protein L35 (RPL35), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RPL35 (11224)
Length:
452
CDS:
46..417

Additional Resources:

NCBI RefSeq record:
NM_007209.4
NBCI Gene record:
RPL35 (11224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007209.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435678 AGATCCGAGTCGTCCGGAAAT pLKO_005 182 CDS 100% 10.800 15.120 N RPL35 n/a
2 TRCN0000421213 GCTCTCTAAGATCCGAGTCGT pLKO_005 174 CDS 100% 2.640 3.696 N RPL35 n/a
3 TRCN0000117387 GCCCGTGTTCTCACAGTTATT pLKO.1 208 CDS 100% 13.200 9.240 N RPL35 n/a
4 TRCN0000430451 GAAATTCTACAAGGGCAAGAA pLKO_005 255 CDS 100% 4.950 3.465 N RPL35 n/a
5 TRCN0000432562 GCCTCCAAGCTCTCTAAGATC pLKO_005 166 CDS 100% 4.950 3.465 N RPL35 n/a
6 TRCN0000117388 GTTATTAACCAGACTCAGAAA pLKO.1 223 CDS 100% 4.950 3.465 N RPL35 n/a
7 TRCN0000117389 CGGAAATCCATTGCCCGTGTT pLKO.1 196 CDS 100% 4.050 2.835 N RPL35 n/a
8 TRCN0000435182 GAAACAGCTGGACGACCTGAA pLKO_005 99 CDS 100% 4.050 2.835 N RPL35 n/a
9 TRCN0000117390 GCCTAAGAAGACACGTGCCAT pLKO.1 297 CDS 100% 2.640 1.848 N RPL35 n/a
10 TRCN0000104417 CAGGAAATTCTACAAGGGCAA pLKO.1 252 CDS 100% 2.160 1.512 N Rpl35 n/a
11 TRCN0000117391 CGGGAAGAAGAAGGAGGAGCT pLKO.1 75 CDS 100% 0.720 0.504 N RPL35 n/a
12 TRCN0000436416 AGAAGGAGGAGCTGCTGAAAC pLKO_005 83 CDS 100% 10.800 5.400 Y RPL35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007209.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02650 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02650 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481144 GCCGCTCGGGGCGGGCTCAGAAGT pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_07775 pDONR223 100% 99.7% 99.1% None 365A>G n/a
5 ccsbBroad304_07775 pLX_304 0% 99.7% 99.1% V5 365A>G n/a
6 TRCN0000471572 CAGGTTTGCGTCCCTCCTCAGACA pLX_317 98.4% 99.7% 99.1% V5 365A>G n/a
Download CSV