Transcript: Human NM_007215.4

Homo sapiens DNA polymerase gamma 2, accessory subunit (POLG2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLG2 (11232)
Length:
1582
CDS:
87..1544

Additional Resources:

NCBI RefSeq record:
NM_007215.4
NBCI Gene record:
POLG2 (11232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007215.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053053 CGCGAAATCTTGCAAGACAAA pLKO.1 546 CDS 100% 4.950 6.930 N POLG2 n/a
2 TRCN0000290539 CGCGAAATCTTGCAAGACAAA pLKO_005 546 CDS 100% 4.950 6.930 N POLG2 n/a
3 TRCN0000053054 CCTCATTGGAACAACTTTATT pLKO.1 1354 CDS 100% 15.000 12.000 N POLG2 n/a
4 TRCN0000290541 CCTCATTGGAACAACTTTATT pLKO_005 1354 CDS 100% 15.000 12.000 N POLG2 n/a
5 TRCN0000053057 GCCTTGGAACACTATGTTAAT pLKO.1 651 CDS 100% 13.200 10.560 N POLG2 n/a
6 TRCN0000290537 GCCTTGGAACACTATGTTAAT pLKO_005 651 CDS 100% 13.200 10.560 N POLG2 n/a
7 TRCN0000053055 CCTGGCAATGTGTCTAAATTA pLKO.1 1032 CDS 100% 15.000 10.500 N POLG2 n/a
8 TRCN0000290540 CCTGGCAATGTGTCTAAATTA pLKO_005 1032 CDS 100% 15.000 10.500 N POLG2 n/a
9 TRCN0000053056 GCATTTCTTGAGAACGTATTA pLKO.1 591 CDS 100% 13.200 9.240 N POLG2 n/a
10 TRCN0000290606 GCATTTCTTGAGAACGTATTA pLKO_005 591 CDS 100% 13.200 9.240 N POLG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007215.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07780 pDONR223 100% 99.9% 99.7% None 1247G>C n/a
2 ccsbBroad304_07780 pLX_304 41.7% 99.9% 99.7% V5 1247G>C n/a
3 TRCN0000468915 TGAGCGAGTGCGAGCCATGCCTCT pLX_317 21.1% 99.9% 99.7% V5 1247G>C n/a
Download CSV