Transcript: Human NM_007244.3

Homo sapiens proline rich 4 (PRR4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PRR4 (11272)
Length:
563
CDS:
39..443

Additional Resources:

NCBI RefSeq record:
NM_007244.3
NBCI Gene record:
PRR4 (11272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160232 CACAGATAATGATGTGAACTA pLKO.1 92 CDS 100% 4.950 3.465 N PRR4 n/a
2 TRCN0000162036 CTTTCACCATACCAGATGTAG pLKO.1 124 CDS 100% 4.950 2.475 Y PRR4 n/a
3 TRCN0000159032 GATGTGAACTATGAAGACTTT pLKO.1 102 CDS 100% 4.950 2.475 Y PRR4 n/a
4 TRCN0000437067 CATTCTTCCAGAGGGACAGAC pLKO_005 388 CDS 100% 4.050 2.025 Y PRR4 n/a
5 TRCN0000163905 CTGGTGATAGTGGTAACCAAG pLKO.1 214 CDS 100% 4.050 2.025 Y PRR4 n/a
6 TRCN0000447333 CAAGTCAGAGACCAGATCAGG pLKO_005 151 CDS 100% 2.640 1.320 Y PRR4 n/a
7 TRCN0000162840 CCATACCAGATGTAGAGGACT pLKO.1 130 CDS 100% 2.640 1.320 Y PRR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07791 pDONR223 100% 99.5% 98.5% None 287G>A;359A>G n/a
2 ccsbBroad304_07791 pLX_304 0% 99.5% 98.5% V5 287G>A;359A>G n/a
3 TRCN0000481102 AAAAACATCTACCATAAAAAAAAC pLX_317 87.2% 99.5% 98.5% V5 287G>A;359A>G n/a
Download CSV