Transcript: Human NM_007253.4

Homo sapiens cytochrome P450 family 4 subfamily F member 8 (CYP4F8), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CYP4F8 (11283)
Length:
2908
CDS:
65..1627

Additional Resources:

NCBI RefSeq record:
NM_007253.4
NBCI Gene record:
CYP4F8 (11283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007253.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425403 TTTCAGATTTCCGGTAATAAA pLKO_005 1685 3UTR 100% 15.000 21.000 N CYP4F8 n/a
2 TRCN0000432137 GATGGGCTCTTGTTAAGTGTT pLKO_005 464 CDS 100% 4.950 6.930 N CYP4F8 n/a
3 TRCN0000064113 GCCCTTGTAGTGAAACGGAAT pLKO.1 752 CDS 100% 4.050 5.670 N CYP4F8 n/a
4 TRCN0000064116 CAAAGGGAATGTCTGTAACAT pLKO.1 1309 CDS 100% 5.625 3.938 N CYP4F8 n/a
5 TRCN0000064117 CATCTTCGCAATCCATCACAA pLKO.1 1333 CDS 100% 4.950 3.465 N CYP4F8 n/a
6 TRCN0000064115 CCGGAAACAGAACTGGTTCTT pLKO.1 226 CDS 100% 4.950 3.465 N CYP4F8 n/a
7 TRCN0000064114 GCCATTACAGACAAGGACATA pLKO.1 410 CDS 100% 4.950 3.465 N CYP4F8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007253.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07253 pDONR223 100% 86% 80.9% None (many diffs) n/a
2 ccsbBroad304_07253 pLX_304 0% 86% 80.9% V5 (many diffs) n/a
3 TRCN0000477423 CCTAGGAGTTGTCCATAAAGAAGC pLX_317 25% 86% 80.9% V5 (many diffs) n/a
Download CSV