Transcript: Human NM_007274.3

Homo sapiens acyl-CoA thioesterase 7 (ACOT7), transcript variant hBACHa, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ACOT7 (11332)
Length:
1814
CDS:
368..1480

Additional Resources:

NCBI RefSeq record:
NM_007274.3
NBCI Gene record:
ACOT7 (11332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007274.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048700 AGGTGCCTCCTGTTGTGTATT pLKO.1 861 CDS 100% 13.200 9.240 N ACOT7 n/a
2 TRCN0000048698 GTCGCTGAAGAATGTGGACAA pLKO.1 832 CDS 100% 4.050 2.835 N ACOT7 n/a
3 TRCN0000048702 CCGGCATTGCAACAGCCAGAA pLKO.1 604 CDS 100% 1.350 0.945 N ACOT7 n/a
4 TRCN0000048701 AGACCAACATCGTCACAGCTT pLKO.1 1137 CDS 100% 2.640 1.584 N ACOT7 n/a
5 TRCN0000048699 GTGACCATGAAGCTCATGGAT pLKO.1 1082 CDS 100% 0.300 0.180 N ACOT7 n/a
6 TRCN0000217466 GCAATAAGTCCATGGAGATTG pLKO.1 1236 CDS 100% 10.800 7.560 N Acot7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007274.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11623 pDONR223 100% 91.3% 91.3% None 1_96del n/a
2 ccsbBroad304_11623 pLX_304 0% 91.3% 91.3% V5 1_96del n/a
3 TRCN0000480330 ACCTCTGGCGGGTTGGATCATTCG pLX_317 42.9% 91.3% 91.3% V5 1_96del n/a
Download CSV