Transcript: Human NM_007353.3

Homo sapiens G protein subunit alpha 12 (GNA12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-25
Taxon:
Homo sapiens (human)
Gene:
GNA12 (2768)
Length:
4369
CDS:
148..1293

Additional Resources:

NCBI RefSeq record:
NM_007353.3
NBCI Gene record:
GNA12 (2768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036756 GCACGAGATAAGCTTGGCATT pLKO.1 478 CDS 100% 4.050 5.670 N GNA12 n/a
2 TRCN0000097863 CGAGACCATCGTCAACAACAA pLKO.1 978 CDS 100% 4.950 3.465 N Gna12 n/a
3 TRCN0000036757 CGTCAACAACAAGCTCTTCTT pLKO.1 987 CDS 100% 4.950 3.465 N GNA12 n/a
4 TRCN0000036758 CCATGCTGTGAAAGACACCAT pLKO.1 1236 CDS 100% 2.640 1.848 N GNA12 n/a
5 TRCN0000036755 GCTGAATTACTTTCCTAGTAA pLKO.1 720 CDS 100% 0.563 0.338 N GNA12 n/a
6 TRCN0000036754 CGAGTGATGATGTTGTGAATA pLKO.1 1525 3UTR 100% 13.200 6.600 Y GNA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489771 ACATACATTAATACTCTCTAACTT pLX_317 18.6% 99.9% 100% V5 (not translated due to prior stop codon) 120C>T n/a
Download CSV