Transcript: Mouse NM_007441.3

Mus musculus aristaless-like homeobox 3 (Alx3), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Alx3 (11694)
Length:
1973
CDS:
146..1177

Additional Resources:

NCBI RefSeq record:
NM_007441.3
NBCI Gene record:
Alx3 (11694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419124 AGGTAGGACTCCTCCTTATAA pLKO_005 1406 3UTR 100% 15.000 21.000 N Alx3 n/a
2 TRCN0000081722 GCGTGAGCGTTATGGGAAGAT pLKO.1 775 CDS 100% 4.950 6.930 N Alx3 n/a
3 TRCN0000433765 ACGGTGAAGGTCAGCTCAATA pLKO_005 1642 3UTR 100% 13.200 9.240 N Alx3 n/a
4 TRCN0000081718 GCTAGTCTACAGAGATACTAT pLKO.1 1713 3UTR 100% 5.625 3.938 N Alx3 n/a
5 TRCN0000081719 CCTCGTTTCACTCAGGATGAA pLKO.1 1117 CDS 100% 4.950 3.465 N Alx3 n/a
6 TRCN0000081720 CCTGGCATCTATTCCATCCAT pLKO.1 1028 CDS 100% 3.000 2.100 N Alx3 n/a
7 TRCN0000081721 ACAGCCTATGACATCTCCGTA pLKO.1 821 CDS 100% 2.640 1.848 N Alx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00059 pDONR223 100% 88.8% 91.8% None (many diffs) n/a
2 ccsbBroad304_00059 pLX_304 0% 88.8% 91.8% V5 (many diffs) n/a
3 TRCN0000476564 CAATGCGGGAATGAAGTTATCGGT pLX_317 30.5% 88.8% 91.8% V5 (many diffs) n/a
Download CSV