Transcript: Mouse NM_007472.2

Mus musculus aquaporin 1 (Aqp1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Aqp1 (11826)
Length:
2760
CDS:
193..1002

Additional Resources:

NCBI RefSeq record:
NM_007472.2
NBCI Gene record:
Aqp1 (11826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119605 GACAATTCACTTGGCCGCAAT pLKO.1 553 CDS 100% 4.050 5.670 N Aqp1 n/a
2 TRCN0000119603 CCTTTGGTTTGAGCATCGCTA pLKO.1 356 CDS 100% 2.640 3.696 N Aqp1 n/a
3 TRCN0000119602 GCCACATTCTTCAGGTGCTTA pLKO.1 2317 3UTR 100% 4.950 3.465 N Aqp1 n/a
4 TRCN0000044132 AGGGTGGAGATGAAGCCCAAA pLKO.1 979 CDS 100% 4.050 2.835 N AQP1 n/a
5 TRCN0000119604 CAACTTCTCAAACCACTGGAT pLKO.1 804 CDS 100% 2.640 1.848 N Aqp1 n/a
6 TRCN0000119606 GCCCTGGCAGTGCTCATCTAT pLKO.1 853 CDS 100% 1.875 1.125 N Aqp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007472.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05841 pDONR223 100% 87.9% 94% None (many diffs) n/a
2 ccsbBroad304_05841 pLX_304 0% 87.9% 94% V5 (many diffs) n/a
3 TRCN0000475825 TATTCACATATGCACATGCTATTT pLX_317 38.6% 87.9% 94% V5 (many diffs) n/a
Download CSV