Transcript: Mouse NM_007477.5

Mus musculus ADP-ribosylation factor 2 (Arf2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Arf2 (11841)
Length:
2673
CDS:
527..1072

Additional Resources:

NCBI RefSeq record:
NM_007477.5
NBCI Gene record:
Arf2 (11841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007477.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349827 ACGACGATCTTGTACAAATTG pLKO_005 617 CDS 100% 13.200 18.480 N Arf2 n/a
2 TRCN0000313214 AGAACACTCAAGGTCTGATTT pLKO_005 774 CDS 100% 13.200 9.240 N Arf2 n/a
3 TRCN0000374562 AGCTCACTTGTAGTGCTTTAA pLKO_005 1488 3UTR 100% 13.200 9.240 N Arf2 n/a
4 TRCN0000313215 TAGACCTTTGTGGCGACATTA pLKO_005 748 CDS 100% 13.200 9.240 N Arf2 n/a
5 TRCN0000100225 CCGTGCCTTATACACGCTATA pLKO.1 1191 3UTR 100% 10.800 7.560 N Arf2 n/a
6 TRCN0000374643 GACCAGTGGAGATGGGCTTTA pLKO_005 1006 CDS 100% 10.800 7.560 N Arf2 n/a
7 TRCN0000100228 GTGGAGACAGTAGAGTACAAA pLKO.1 683 CDS 100% 5.625 3.938 N Arf2 n/a
8 TRCN0000100226 CCGGGAAGAATTGACCAGAAT pLKO.1 835 CDS 100% 4.950 3.465 N Arf2 n/a
9 TRCN0000100229 GATGCAGTCTTGTTGGTGTTT pLKO.1 878 CDS 100% 4.950 3.465 N Arf2 n/a
10 TRCN0000349423 GATGCAGTCTTGTTGGTGTTT pLKO_005 878 CDS 100% 4.950 3.465 N Arf2 n/a
11 TRCN0000100227 CGGATTCTCATGGTGGGCTTA pLKO.1 581 CDS 100% 4.050 2.835 N Arf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007477.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00095 pDONR223 100% 81.3% 94.4% None (many diffs) n/a
2 ccsbBroad304_00095 pLX_304 0% 81.3% 94.4% V5 (many diffs) n/a
3 TRCN0000467892 AAGACCTTCCAAGGGGGGATCTAG pLX_317 85.4% 81.3% 94.4% V5 (many diffs) n/a
Download CSV