Transcript: Mouse NM_007480.1

Mus musculus ADP-ribosylation factor 5 (Arf5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Arf5 (11844)
Length:
933
CDS:
50..592

Additional Resources:

NCBI RefSeq record:
NM_007480.1
NBCI Gene record:
Arf5 (11844)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100236 GCGGATCCTTATGGTTGGCTT pLKO.1 103 CDS 100% 2.640 3.696 N Arf5 n/a
2 TRCN0000100237 CCACGAGCTGTCAAAGCGCTA pLKO.1 571 CDS 100% 0.720 1.008 N Arf5 n/a
3 TRCN0000100235 TGGCAAGACTACCATCCTGTA pLKO.1 133 CDS 100% 4.050 3.240 N Arf5 n/a
4 TRCN0000381862 GAAGCAGATGCGGATCCTTAT pLKO_005 94 CDS 100% 10.800 7.560 N Arf5 n/a
5 TRCN0000381650 TGCTGATGAACTCCAGAAGAT pLKO_005 358 CDS 100% 4.950 3.465 N Arf5 n/a
6 TRCN0000382130 GCATGCTCTCTCTTGTCGTTG pLKO_005 730 3UTR 100% 4.050 2.835 N Arf5 n/a
7 TRCN0000381049 CTGTCCCACGAGCTGTCAAAG pLKO_005 566 CDS 100% 3.600 2.520 N Arf5 n/a
8 TRCN0000100238 CGGGTCCAGGAGTCTGCTGAT pLKO.1 344 CDS 100% 0.000 0.000 N Arf5 n/a
9 TRCN0000100239 CAATGTGGAAACAGTGGAATA pLKO.1 202 CDS 100% 10.800 6.480 N Arf5 n/a
10 TRCN0000379985 AGAACATCTGTTTCACAGTGT pLKO_005 225 CDS 100% 2.640 1.584 N Arf5 n/a
11 TRCN0000381293 ACTCCTCAGGCAGTGCCCTTT pLKO_005 660 3UTR 100% 1.350 0.945 N ARF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00096 pDONR223 100% 94.2% 100% None (many diffs) n/a
2 ccsbBroad304_00096 pLX_304 0% 94.2% 100% V5 (many diffs) n/a
3 TRCN0000467030 CCCCGAAGACACACTGGGCAACCC pLX_317 74.1% 94.2% 100% V5 (many diffs) n/a
Download CSV