Transcript: Mouse NM_007531.2

Mus musculus prohibitin 2 (Phb2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Phb2 (12034)
Length:
1360
CDS:
149..1048

Additional Resources:

NCBI RefSeq record:
NM_007531.2
NBCI Gene record:
Phb2 (12034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007531.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054429 GCCTCATTAAGGGTAAGAAAT pLKO.1 1026 CDS 100% 13.200 9.240 N Phb2 n/a
2 TRCN0000302352 GCCTCATTAAGGGTAAGAAAT pLKO_005 1026 CDS 100% 13.200 9.240 N Phb2 n/a
3 TRCN0000054431 GCTGACAACCTTGTGCTGAAT pLKO.1 971 CDS 100% 4.950 3.465 N Phb2 n/a
4 TRCN0000302294 GCTGACAACCTTGTGCTGAAT pLKO_005 971 CDS 100% 4.950 3.465 N Phb2 n/a
5 TRCN0000054430 CTGAGCAAGAATCCTGGCTAT pLKO.1 872 CDS 100% 4.050 2.835 N Phb2 n/a
6 TRCN0000302351 CTGAGCAAGAATCCTGGCTAT pLKO_005 872 CDS 100% 4.050 2.835 N Phb2 n/a
7 TRCN0000054432 CCCAGCATGTACCAGCGTCTA pLKO.1 500 CDS 100% 1.350 0.945 N Phb2 n/a
8 TRCN0000054428 AGGCATCATGTGATGGACTTT pLKO.1 1144 3UTR 100% 4.950 2.970 N Phb2 n/a
9 TRCN0000302350 AGGCATCATGTGATGGACTTT pLKO_005 1144 3UTR 100% 4.950 2.970 N Phb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007531.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02676 pDONR223 100% 91.3% 100% None (many diffs) n/a
2 ccsbBroad304_02676 pLX_304 0% 91.3% 100% V5 (many diffs) n/a
3 TRCN0000469876 TTCTACGGCAAACCCGTACGCGAC pLX_317 41.3% 91.3% 100% V5 (many diffs) n/a
Download CSV