Transcript: Mouse NM_007552.4

Mus musculus Bmi1 polycomb ring finger oncogene (Bmi1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Bmi1 (12151)
Length:
3594
CDS:
472..1446

Additional Resources:

NCBI RefSeq record:
NM_007552.4
NBCI Gene record:
Bmi1 (12151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235391 AGCGGGTACTACCGTTTATTT pLKO_005 2020 3UTR 100% 15.000 21.000 N Bmi1 n/a
2 TRCN0000012563 CCTAAGGAAGAGGTGAATGAT pLKO.1 925 CDS 100% 5.625 3.938 N Bmi1 n/a
3 TRCN0000012567 GCAGATTGGATCGGAAAGTAA pLKO.1 893 CDS 100% 5.625 3.938 N Bmi1 n/a
4 TRCN0000235387 GATGAGGAGAAGAGGATTATA pLKO_005 826 CDS 100% 15.000 9.000 N Bmi1 n/a
5 TRCN0000218869 CAGATTGGATCGGAAAGTAAA pLKO_005 894 CDS 100% 13.200 7.920 N BMI1 n/a
6 TRCN0000012565 CCAGCAAGTATTGTCCTATTT pLKO.1 617 CDS 100% 13.200 7.920 N Bmi1 n/a
7 TRCN0000012566 CCTGAACATAAGGTCAGATAA pLKO.1 669 CDS 100% 13.200 7.920 N Bmi1 n/a
8 TRCN0000235390 ATTGATGCCACTACCATAATA pLKO_005 547 CDS 100% 15.000 7.500 Y Bmi1 n/a
9 TRCN0000235389 CAGCAAGTATTGTCCTATTTG pLKO_005 618 CDS 100% 13.200 6.600 Y Bmi1 n/a
10 TRCN0000235388 TAATGGACATTGCCTACATTT pLKO_005 1082 CDS 100% 13.200 6.600 Y Bmi1 n/a
11 TRCN0000020154 CCTACATTTATACCTGGAGAA pLKO.1 1094 CDS 100% 4.050 2.025 Y BMI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00165 pDONR223 100% 92% 96.9% None (many diffs) n/a
2 ccsbBroad304_00165 pLX_304 58.2% 92% 96.9% V5 (many diffs) n/a
3 TRCN0000474550 GTACCTAGACTTTCTACTCCCTTC pLX_317 55.7% 92% 96.9% V5 (many diffs) n/a
Download CSV