Transcript: Mouse NM_007596.2

Mus musculus calcium modulating ligand (Caml), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Caml (12328)
Length:
1387
CDS:
87..971

Additional Resources:

NCBI RefSeq record:
NM_007596.2
NBCI Gene record:
Caml (12328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100982 ACGGCCTAGAACAGTACCTTT pLKO.1 529 CDS 100% 4.950 6.930 N Caml n/a
2 TRCN0000306405 CAAACTGGACTCATTCATTAA pLKO_005 416 CDS 100% 13.200 9.240 N Caml n/a
3 TRCN0000100980 CCCGAGGAACTTAGAAGTTTA pLKO.1 974 3UTR 100% 13.200 9.240 N Caml n/a
4 TRCN0000326848 CCCGAGGAACTTAGAAGTTTA pLKO_005 974 3UTR 100% 13.200 9.240 N Caml n/a
5 TRCN0000311541 GCACCAGAGTGCAGTAGTAAG pLKO_005 438 CDS 100% 10.800 7.560 N Caml n/a
6 TRCN0000100983 CAGCTTGCATACATGGGACTA pLKO.1 741 CDS 100% 4.050 2.835 N Caml n/a
7 TRCN0000326847 CAGCTTGCATACATGGGACTA pLKO_005 741 CDS 100% 4.050 2.835 N Caml n/a
8 TRCN0000100981 CGCGGAAGAGTTTGACTCTTT pLKO.1 623 CDS 100% 0.495 0.347 N Caml n/a
9 TRCN0000100984 CCATTTCTCACTTTGCAGCTT pLKO.1 726 CDS 100% 2.640 1.584 N Caml n/a
10 TRCN0000326849 CCATTTCTCACTTTGCAGCTT pLKO_005 726 CDS 100% 2.640 1.584 N Caml n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00212 pDONR223 100% 83.1% 88.8% None (many diffs) n/a
2 ccsbBroad304_00212 pLX_304 0% 83.1% 88.8% V5 (many diffs) n/a
3 TRCN0000475585 CCGCATAAGGCCAGATCGGTGCTC pLX_317 32.4% 83.1% 88.8% V5 (many diffs) n/a
Download CSV