Transcript: Mouse NM_007807.5

Mus musculus cytochrome b-245, beta polypeptide (Cybb), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cybb (13058)
Length:
4750
CDS:
75..1787

Additional Resources:

NCBI RefSeq record:
NM_007807.5
NBCI Gene record:
Cybb (13058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007807.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435339 GAACGAAGAGTATCTCAATTT pLKO_005 518 CDS 100% 13.200 18.480 N Cybb n/a
2 TRCN0000422819 ATGATGATGGGCCTAAGTATA pLKO_005 172 CDS 100% 13.200 9.240 N Cybb n/a
3 TRCN0000011888 GCTGCCAAATGTCCCAGTAAT pLKO.1 1818 3UTR 100% 13.200 9.240 N Cybb n/a
4 TRCN0000415639 TCCATGGAGCTGAACGAATTG pLKO_005 736 CDS 100% 10.800 7.560 N Cybb n/a
5 TRCN0000428504 TCCATGGAGCTGAACGAATTG pLKO_005 736 CDS 100% 10.800 7.560 N CYBB n/a
6 TRCN0000011889 CCTGCCTGAATTTCAACTGTA pLKO.1 247 CDS 100% 4.950 3.465 N Cybb n/a
7 TRCN0000011891 CGGAGAGTTTGGAAGAGCATA pLKO.1 772 CDS 100% 4.950 3.465 N Cybb n/a
8 TRCN0000011892 GCCTGGAAACTACCTAAGATA pLKO.1 1209 CDS 100% 5.625 3.375 N Cybb n/a
9 TRCN0000064591 CCTATGACTTGGAAATGGATA pLKO.1 873 CDS 100% 4.950 2.970 N CYBB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007807.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00403 pDONR223 100% 87.5% 93.1% None (many diffs) n/a
2 ccsbBroad304_00403 pLX_304 0% 87.5% 93.1% V5 (many diffs) n/a
3 TRCN0000475893 CACCGTCACGGTGCCGGGGGGCGC pLX_317 17.3% 87.5% 93.1% V5 (many diffs) n/a
Download CSV