Transcript: Mouse NM_007854.3

Mus musculus solute carrier family 29 (nucleoside transporters), member 2 (Slc29a2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Slc29a2 (13340)
Length:
2490
CDS:
244..1614

Additional Resources:

NCBI RefSeq record:
NM_007854.3
NBCI Gene record:
Slc29a2 (13340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079706 TCTGAAGTTTGCCCGTTACTA pLKO.1 885 CDS 100% 5.625 7.875 N Slc29a2 n/a
2 TRCN0000079703 CGACTGTCTATGGAAGAGTAA pLKO.1 2281 3UTR 100% 4.950 6.930 N Slc29a2 n/a
3 TRCN0000079707 ACCTTCAGTCTTTGTTGTCTT pLKO.1 1077 CDS 100% 4.950 3.465 N Slc29a2 n/a
4 TRCN0000079704 CCTTGCTATGCTCATGTCCTT pLKO.1 765 CDS 100% 2.640 1.848 N Slc29a2 n/a
5 TRCN0000079705 CTACTTGGTGTCTCTCACCAT pLKO.1 1467 CDS 100% 0.264 0.158 N Slc29a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007854.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488446 CTTCCCTGGACTCGCGATCGACTA pLX_317 20.3% 86.6% 88.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV