Transcript: Mouse NM_007857.5

Mus musculus desert hedgehog (Dhh), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Dhh (13363)
Length:
4239
CDS:
269..1459

Additional Resources:

NCBI RefSeq record:
NM_007857.5
NBCI Gene record:
Dhh (13363)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007857.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031069 CCGTAATAAGTATGGTTTGTT pLKO.1 733 CDS 100% 5.625 7.875 N Dhh n/a
2 TRCN0000031071 CACATCCACGTATCGGTCAAA pLKO.1 809 CDS 100% 4.950 6.930 N Dhh n/a
3 TRCN0000031072 CAGGATTCACTCCACTACGAA pLKO.1 677 CDS 100% 3.000 2.100 N Dhh n/a
4 TRCN0000031073 CCTGTGCTGCTTGGCACTCTT pLKO.1 295 CDS 100% 1.650 1.155 N Dhh n/a
5 TRCN0000031070 CCTCTGCTATACAAGCAGTTT pLKO.1 392 CDS 100% 0.495 0.347 N Dhh n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2492 3UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 2508 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007857.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03155 pDONR223 100% 88.3% 96.4% None (many diffs) n/a
2 ccsbBroad304_03155 pLX_304 0% 88.3% 96.4% V5 (many diffs) n/a
3 TRCN0000476757 TGCTCGCTCCCCGGGTTGCCTTGT pLX_317 31.8% 88.3% 96.4% V5 (many diffs) n/a
Download CSV