Construct: ORF TRCN0000476757
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013279.1_s317c1
- Derived from:
- ccsbBroadEn_03155
- DNA Barcode:
- TGCTCGCTCCCCGGGTTGCCTTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DHH (50846)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476757
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 50846 | DHH | desert hedgehog signaling m... | NM_021044.4 | 100% | 100% | |
| 2 | human | 50846 | DHH | desert hedgehog signaling m... | XM_017019380.1 | 82.8% | 77% | (many diffs) |
| 3 | human | 50846 | DHH | desert hedgehog signaling m... | XM_017019381.1 | 71.2% | 71.2% | 0_1ins342 |
| 4 | mouse | 13363 | Dhh | desert hedgehog | NM_007857.5 | 88.3% | 96.4% | (many diffs) |
| 5 | mouse | 13363 | Dhh | desert hedgehog | XR_875235.2 | 63.5% | (many diffs) | |
| 6 | mouse | 13363 | Dhh | desert hedgehog | XM_006520406.3 | 63.2% | 69.6% | (many diffs) |
| 7 | mouse | 13363 | Dhh | desert hedgehog | XM_017316427.1 | 63.2% | 69.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1254
- ORF length:
- 1188
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tctcctgacc aatctactgc ccctgtgctg cttggcactt ctggcgctgc 121 cagcccagag ctgcgggccg ggccgggggc cggttggccg gcgccgctat gcgcgcaagc 181 agctcgtgcc gctactctac aagcaatttg tgcccggcgt gccagagcgg accctgggcg 241 ccagtgggcc agcggagggg agggtggcaa ggggctccga gcgcttccgg gacctcgtgc 301 ccaactacaa ccccgacatc atcttcaagg atgaggagaa cagtggagcc gaccgcctga 361 tgaccgagcg ttgtaaggag cgggtgaacg ctttggccat tgccgtgatg aacatgtggc 421 ccggagtgcg cctacgagtg actgagggct gggacgagga cggccaccac gctcaggatt 481 cactccacta cgaaggccgt gctttggaca tcactacgtc tgaccgcgac cgcaacaagt 541 atgggttgct ggcgcgcctc gcagtggaag ccggcttcga ctgggtctac tacgagtccc 601 gcaaccacgt ccacgtgtcg gtcaaagctg ataactcact ggcggtccgg gcgggcggct 661 gctttccggg aaatgcaact gtgcgcctgt ggagcggcga gcggaaaggg ctgcgggaac 721 tgcaccgcgg agactgggtt ttggcggccg atgcgtcagg ccgggtggtg cccacgccgg 781 tgctgctctt cctggaccgg gacttgcagc gccgggcttc atttgtggct gtggagaccg 841 agtggcctcc acgcaaactg ttgctcacgc cctggcaccT GGTGTTTGCC GCTCGAGGGC 901 CGGCGCCCGC GCCAGGCGAC TTTGCACCGG TGTTCGCGCG CCGGCTACGC GCTGGGGACT 961 CGGTGCTGGC GCCCGGCGGG GATGCGCTTC GGCCAGCGCG CGTGGCCCGT GTGGCGCGGG 1021 AGGAAGCCGT GGGCGTGTTC GCGCCGCTCA CCGCGCACGG GACGCTGCTG GTGAACGATG 1081 TCCTGGCCTC TTGCTACGCG GTTCTGGAGA GTCACCAGTG GGCGCACCGC GCTTTTGCCC 1141 CCTTGAGACT GCTGCACGCG CTAGGGGCGC TGCTCCCCGG CGGGGCCGTC CAGCCGACTG 1201 GCATGCATTG GTACTCTCGG CTCCTCTACC GCTTAGCGGA GGAGCTACTG GGCTGCCCAA 1261 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1321 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1381 TATCTTGTGG AAAGGACGAT GCTCGCTCCC CGGGTTGCCT TGTACGCGTT AAGTCgacaa 1441 tcaacctctg gattacaaaa tttgtgaaag att