Transcript: Mouse NM_007874.3

Mus musculus receptor accessory protein 5 (Reep5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Reep5 (13476)
Length:
2910
CDS:
95..664

Additional Resources:

NCBI RefSeq record:
NM_007874.3
NBCI Gene record:
Reep5 (13476)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106187 GCGAATCATCCGTCCTATCTT pLKO.1 508 CDS 100% 5.625 7.875 N Reep5 n/a
2 TRCN0000335519 GCGAATCATCCGTCCTATCTT pLKO_005 508 CDS 100% 5.625 7.875 N Reep5 n/a
3 TRCN0000106186 GCAACCTGATAGGTTTCGGAT pLKO.1 270 CDS 100% 2.640 3.696 N Reep5 n/a
4 TRCN0000335598 GCAACCTGATAGGTTTCGGAT pLKO_005 270 CDS 100% 2.640 3.696 N Reep5 n/a
5 TRCN0000106188 CAGGCGAATCATCCGTCCTAT pLKO.1 505 CDS 100% 4.950 3.960 N Reep5 n/a
6 TRCN0000106185 GCTGGAAACAAAGCATTTATT pLKO.1 2500 3UTR 100% 15.000 10.500 N Reep5 n/a
7 TRCN0000348633 TTTGCCTTTGTTGTCGTATAT pLKO_005 797 3UTR 100% 13.200 9.240 N Reep5 n/a
8 TRCN0000106189 CGAATTCTTCTCCGATCTCTT pLKO.1 391 CDS 100% 0.000 0.000 N Reep5 n/a
9 TRCN0000335518 CGAATTCTTCTCCGATCTCTT pLKO_005 391 CDS 100% 0.000 0.000 N Reep5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11247 pDONR223 100% 88.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_11247 pLX_304 0% 88.7% 91.5% V5 (many diffs) n/a
3 TRCN0000468254 TCGACGGACATGGGAAAGATCAAC pLX_317 67.1% 88.7% 91.5% V5 (many diffs) n/a
Download CSV