Transcript: Mouse NM_007951.4

Mus musculus enhancer of rudimentary homolog (Drosophila) (Erh), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Erh (13877)
Length:
1082
CDS:
346..660

Additional Resources:

NCBI RefSeq record:
NM_007951.4
NBCI Gene record:
Erh (13877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007951.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239977 CAGACATACCAGCCGTATAAC pLKO_005 574 CDS 100% 13.200 18.480 N n/a
2 TRCN0000055001 CCCTTCCATCACATACGATAT pLKO.1 486 CDS 100% 10.800 15.120 N Erh n/a
3 TRCN0000239974 CCAACAGGCTGGGAAGTAATT pLKO_005 642 CDS 100% 13.200 9.240 N n/a
4 TRCN0000054999 CCGAGCTGATACACAGACATA pLKO.1 561 CDS 100% 4.950 3.465 N Erh n/a
5 TRCN0000055000 GCTGACTATGAGTCTGTGAAT pLKO.1 403 CDS 100% 4.950 3.465 N Erh n/a
6 TRCN0000055002 GCCGTATAACAAAGACTGGAT pLKO.1 585 CDS 100% 2.640 1.848 N Erh n/a
7 TRCN0000239975 GGACTTGGAACAGGTACATAA pLKO_005 689 3UTR 100% 13.200 9.240 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007951.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00515 pDONR223 100% 92.9% 100% None (many diffs) n/a
2 ccsbBroad304_00515 pLX_304 0% 92.9% 100% V5 (many diffs) n/a
3 TRCN0000470059 CAAATAGACCACTTGCACTGCATC pLX_317 100% 92.9% 100% V5 (many diffs) n/a
Download CSV