Transcript: Mouse NM_007986.3

Mus musculus fibroblast activation protein (Fap), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fap (14089)
Length:
2704
CDS:
171..2456

Additional Resources:

NCBI RefSeq record:
NM_007986.3
NBCI Gene record:
Fap (14089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031327 CCATATATATATTCCGCGTAA pLKO.1 1360 CDS 100% 4.050 5.670 N Fap n/a
2 TRCN0000031324 GCCTATTCTTATTATGGTGAT pLKO.1 873 CDS 100% 4.050 5.670 N Fap n/a
3 TRCN0000031328 CGCTCCCAGAATCATTTATAT pLKO.1 2388 CDS 100% 15.000 10.500 N Fap n/a
4 TRCN0000031326 CCCTTTGCTAATTCAAGTGTA pLKO.1 1772 CDS 100% 4.950 3.465 N Fap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491844 GTTATGGCCCGAAGTTCCCCCTTC pLX_317 9.2% 89.4% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489227 CAGGGGTGGAGGGGATATCAACAT pLX_317 16.7% 89.4% 89.3% V5 (many diffs) n/a
Download CSV