Transcript: Mouse NM_007994.3

Mus musculus fructose bisphosphatase 2 (Fbp2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fbp2 (14120)
Length:
1294
CDS:
74..1093

Additional Resources:

NCBI RefSeq record:
NM_007994.3
NBCI Gene record:
Fbp2 (14120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418438 GACCCTGACCCGTTACGTTAT pLKO_005 109 CDS 100% 10.800 7.560 N Fbp2 n/a
2 TRCN0000080672 GCCAACCAGAAGAGTCCTAAT pLKO.1 872 CDS 100% 10.800 7.560 N Fbp2 n/a
3 TRCN0000445073 GCTGCTACTGCTGAGTATGTA pLKO_005 737 CDS 100% 5.625 3.938 N Fbp2 n/a
4 TRCN0000080671 CCTGAGGATGTGCAAGAGTAT pLKO.1 1037 CDS 100% 4.950 3.465 N Fbp2 n/a
5 TRCN0000080670 CGGCTCCTGTATGAATGCAAT pLKO.1 902 CDS 100% 4.950 3.465 N Fbp2 n/a
6 TRCN0000080668 AGATGAATGAGCTATGGAGAT pLKO.1 1146 3UTR 100% 4.050 2.835 N Fbp2 n/a
7 TRCN0000080669 CGGATTAAGAAGAAAGGGAAA pLKO.1 677 CDS 100% 4.050 2.835 N Fbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07301 pDONR223 100% 87.2% 94.3% None (many diffs) n/a
2 ccsbBroad304_07301 pLX_304 0% 87.2% 94.3% V5 (many diffs) n/a
3 TRCN0000491699 TAGTGATTCCAATTCAGTTAATCT pLX_317 29.6% 87.2% 94.3% V5 (many diffs) n/a
Download CSV