Transcript: Mouse NM_008048.3

Mus musculus insulin-like growth factor binding protein 7 (Igfbp7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Igfbp7 (29817)
Length:
1120
CDS:
32..880

Additional Resources:

NCBI RefSeq record:
NM_008048.3
NBCI Gene record:
Igfbp7 (29817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008048.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080111 GCATGAAGTAACGGGCTGGGT pLKO.1 709 CDS 100% 0.220 0.308 N Igfbp7 n/a
2 TRCN0000077944 GCTGGTATCTCCTCTAAGTAA pLKO.1 730 CDS 100% 5.625 4.500 N IGFBP7 n/a
3 TRCN0000080109 CCTCATCTGGAACAAGGTAAA pLKO.1 601 CDS 100% 10.800 7.560 N Igfbp7 n/a
4 TRCN0000080108 CCTCCATGAAATACCACTGAA pLKO.1 835 CDS 100% 4.950 3.465 N Igfbp7 n/a
5 TRCN0000080110 CCTCGCCGTGTGCGTGTGCAA pLKO.1 352 CDS 100% 0.000 0.000 N Igfbp7 n/a
6 TRCN0000080112 CGGCAGCAACGGCATCACCTA pLKO.1 391 CDS 100% 0.000 0.000 N Igfbp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008048.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00840 pDONR223 100% 90% 90.8% None (many diffs) n/a
2 ccsbBroad304_00840 pLX_304 0% 90% 90.8% V5 (many diffs) n/a
3 TRCN0000477428 GTTTCAAAAAATCTAATCGCTTCG pLX_317 38.4% 90% 90.8% V5 (many diffs) n/a
Download CSV