Transcript: Mouse NM_008066.3

Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2 (Gabra2), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Gabra2 (14395)
Length:
2392
CDS:
292..1647

Additional Resources:

NCBI RefSeq record:
NM_008066.3
NBCI Gene record:
Gabra2 (14395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009906 GCGTTTGTGTTCTCTGCCCTA pLKO.1 1255 CDS 100% 2.160 3.024 N Gabra2 n/a
2 TRCN0000009893 GGCTCCAGGTTAAATCAGTAT pLKO.1 925 CDS 100% 4.950 3.960 N Gabra2 n/a
3 TRCN0000423829 CTGAAGTCTTCACTAACATTT pLKO_005 488 CDS 100% 13.200 9.240 N Gabra2 n/a
4 TRCN0000424563 ACGGGAAGAGTGTAGTCAATG pLKO_005 1325 CDS 100% 10.800 7.560 N Gabra2 n/a
5 TRCN0000009907 GATCCTGTCCTCTCTACCATT pLKO.1 1432 CDS 100% 4.950 3.465 N Gabra2 n/a
6 TRCN0000061181 GCCCTGTCTCAGATACAGATA pLKO.1 524 CDS 100% 4.950 3.465 N GABRA2 n/a
7 TRCN0000009902 TGGACTGGTTTATAGCTGTTT pLKO.1 1229 CDS 100% 4.950 3.465 N Gabra2 n/a
8 TRCN0000009892 AGTCCAAGCCGAATGTCCCAT pLKO.1 774 CDS 100% 2.640 1.848 N Gabra2 n/a
9 TRCN0000061179 CCTATGAATATCCTTCGACTA pLKO.1 610 CDS 100% 4.050 5.670 N GABRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10832 pDONR223 100% 72.8% 77.1% None (many diffs) n/a
2 ccsbBroad304_10832 pLX_304 0% 72.8% 77.1% V5 (many diffs) n/a
Download CSV