Transcript: Mouse NM_008071.3

Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 (Gabrb3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gabrb3 (14402)
Length:
5568
CDS:
104..1525

Additional Resources:

NCBI RefSeq record:
NM_008071.3
NBCI Gene record:
Gabrb3 (14402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102846 CCCTGATCTAACCGATGTGAA pLKO.1 1420 CDS 100% 4.950 6.930 N Gabrb3 n/a
2 TRCN0000326370 CCCTGATCTAACCGATGTGAA pLKO_005 1420 CDS 100% 4.950 6.930 N Gabrb3 n/a
3 TRCN0000061490 CCCGACACATATTTCTTAAAT pLKO.1 458 CDS 100% 15.000 10.500 N GABRB3 n/a
4 TRCN0000299568 CCCGACACATATTTCTTAAAT pLKO_005 458 CDS 100% 15.000 10.500 N GABRB3 n/a
5 TRCN0000102845 CCAGATTTCTAGGTCTGCTAT pLKO.1 2370 3UTR 100% 4.950 3.465 N Gabrb3 n/a
6 TRCN0000326372 CCAGATTTCTAGGTCTGCTAT pLKO_005 2370 3UTR 100% 4.950 3.465 N Gabrb3 n/a
7 TRCN0000102847 CGACATGGTTTCTGAAGTCAA pLKO.1 319 CDS 100% 4.950 3.465 N Gabrb3 n/a
8 TRCN0000326447 CGACATGGTTTCTGAAGTCAA pLKO_005 319 CDS 100% 4.950 3.465 N Gabrb3 n/a
9 TRCN0000102848 GCACCGATGGATGTTCACAAT pLKO.1 1211 CDS 100% 4.950 3.465 N Gabrb3 n/a
10 TRCN0000326446 GCACCGATGGATGTTCACAAT pLKO_005 1211 CDS 100% 4.950 3.465 N Gabrb3 n/a
11 TRCN0000102849 ACAACCATCAACACTCACCTT pLKO.1 962 CDS 100% 2.640 1.584 N Gabrb3 n/a
12 TRCN0000326371 ACAACCATCAACACTCACCTT pLKO_005 962 CDS 100% 2.640 1.584 N Gabrb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.