Transcript: Mouse NM_008072.2

Mus musculus gamma-aminobutyric acid (GABA) A receptor, subunit delta (Gabrd), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gabrd (14403)
Length:
1896
CDS:
108..1457

Additional Resources:

NCBI RefSeq record:
NM_008072.2
NBCI Gene record:
Gabrd (14403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102967 CCAGTTCACTATCACCAGTTA pLKO.1 743 CDS 100% 4.950 6.930 N Gabrd n/a
2 TRCN0000102969 GCTGTCCTACAACCATACCAA pLKO.1 404 CDS 100% 3.000 2.400 N Gabrd n/a
3 TRCN0000102965 CTTGGGCTTTACCTCAACTTT pLKO.1 1572 3UTR 100% 5.625 3.938 N Gabrd n/a
4 TRCN0000102968 GCAGACACCATCGACATCTAT pLKO.1 1368 CDS 100% 5.625 3.938 N Gabrd n/a
5 TRCN0000102966 GCCAGGGCAATGAATGACATT pLKO.1 171 CDS 100% 4.950 3.465 N Gabrd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008072.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06244 pDONR223 100% 85.3% 92% None (many diffs) n/a
2 ccsbBroad304_06244 pLX_304 0% 85.3% 92% V5 (many diffs) n/a
3 TRCN0000472474 GATAAATCTGAACAACTCAACATT pLX_317 34.3% 85.3% 92% V5 (many diffs) n/a
Download CSV