Transcript: Mouse NM_008129.4

Mus musculus glutamate-cysteine ligase, modifier subunit (Gclm), mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Mus musculus (mouse)
Gene:
Gclm (14630)
Length:
2072
CDS:
430..1254

Additional Resources:

NCBI RefSeq record:
NM_008129.4
NBCI Gene record:
Gclm (14630)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008129.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120828 CCCGATTTAGTCAGGGAGTTT pLKO.1 607 CDS 100% 4.950 6.930 N Gclm n/a
2 TRCN0000345311 CCCGATTTAGTCAGGGAGTTT pLKO_005 607 CDS 100% 4.950 6.930 N Gclm n/a
3 TRCN0000120831 GTTAATCTTTCCTTGGAGCAT pLKO.1 835 CDS 100% 2.640 2.112 N Gclm n/a
4 TRCN0000345313 GTTAATCTTTCCTTGGAGCAT pLKO_005 835 CDS 100% 2.640 2.112 N Gclm n/a
5 TRCN0000120827 CCTGCTGTTGTCTGGAACATA pLKO.1 1282 3UTR 100% 5.625 3.938 N Gclm n/a
6 TRCN0000120830 CTCCGATTGAAGATGGAGTTA pLKO.1 818 CDS 100% 4.950 3.465 N Gclm n/a
7 TRCN0000345242 CTCCGATTGAAGATGGAGTTA pLKO_005 818 CDS 100% 4.950 3.465 N Gclm n/a
8 TRCN0000120829 CCACCAGATTTGACTGCCTTT pLKO.1 1018 CDS 100% 4.050 2.835 N Gclm n/a
9 TRCN0000048492 CCTTGGAGCATTTACAGCCTT pLKO.1 845 CDS 100% 2.640 1.848 N GCLM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008129.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00645 pDONR223 100% 91.3% 96.3% None (many diffs) n/a
2 ccsbBroad304_00645 pLX_304 0% 91.3% 96.3% V5 (many diffs) n/a
3 TRCN0000465267 TGCACAATCACATTTAATCCTCGT pLX_317 1.4% 91.3% 96.3% V5 (many diffs) n/a
Download CSV