Transcript: Mouse NM_008137.4

Mus musculus guanine nucleotide binding protein, alpha 14 (Gna14), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gna14 (14675)
Length:
3383
CDS:
1028..2095

Additional Resources:

NCBI RefSeq record:
NM_008137.4
NBCI Gene record:
Gna14 (14675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098250 CCGAGCTATATCCCAAACCAA pLKO.1 3003 3UTR 100% 3.000 4.200 N Gna14 n/a
2 TRCN0000098252 GCTGTCAGACTCTGCCAAATA pLKO.1 1471 CDS 100% 13.200 9.240 N Gna14 n/a
3 TRCN0000098254 GCAATGGATACCCTGAGGATA pLKO.1 1292 CDS 100% 4.950 3.465 N Gna14 n/a
4 TRCN0000098251 GCTGTCAAAGACACAATCCTA pLKO.1 2042 CDS 100% 3.000 2.100 N Gna14 n/a
5 TRCN0000098253 CGTGATTCTGTTCTTAAACAA pLKO.1 1819 CDS 100% 5.625 3.375 N Gna14 n/a
6 TRCN0000036762 GACACCGAGAATATCCGCTTT pLKO.1 2012 CDS 100% 4.050 2.430 N GNAQ n/a
7 TRCN0000333237 GACACCGAGAATATCCGCTTT pLKO_005 2012 CDS 100% 4.050 2.430 N GNAQ n/a
8 TRCN0000036880 GCTGCTGTCAAAGACACAATT pLKO.1 2039 CDS 100% 13.200 9.240 N GNA14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14942 pDONR223 97.8% 89.3% 96.6% None (many diffs) n/a
2 ccsbBroad304_14942 pLX_304 0% 89.3% 96.6% V5 (many diffs) n/a
3 TRCN0000469606 AAGCACGTCTTTTGCCCATGGCGC pLX_317 36.3% 89.3% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV