Transcript: Mouse NM_008169.3

Mus musculus glutamate receptor, ionotropic, NMDA1 (zeta 1) (Grin1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Grin1 (14810)
Length:
4326
CDS:
302..3118

Additional Resources:

NCBI RefSeq record:
NM_008169.3
NBCI Gene record:
Grin1 (14810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257394 CCGGAAGTTTGCCAACTATAG pLKO_005 1336 CDS 100% 10.800 15.120 N Grin1 n/a
2 TRCN0000100293 CCACCAGACTAAAGATAGTGA pLKO.1 1485 CDS 100% 3.000 4.200 N Grin1 n/a
3 TRCN0000233326 GGTCTACGCTATCCTAGTTAG pLKO_005 559 CDS 100% 10.800 8.640 N Grin1 n/a
4 TRCN0000100291 CGTGTATGTCAAGCCCACAAT pLKO.1 1525 CDS 100% 4.950 3.960 N Grin1 n/a
5 TRCN0000233328 CAGTCCCTTTGGCCGATTTAA pLKO_005 2050 CDS 100% 15.000 10.500 N Grin1 n/a
6 TRCN0000063370 GCAGTACCATCCCACTGATAT pLKO.1 3357 3UTR 100% 13.200 9.240 N GRIN1 n/a
7 TRCN0000233327 GTGGCTCCACTGACCATTAAC pLKO_005 1841 CDS 100% 13.200 9.240 N Grin1 n/a
8 TRCN0000233329 AGCGCATCACAGGCATCAATG pLKO_005 2286 CDS 100% 10.800 7.560 N Grin1 n/a
9 TRCN0000100290 CGTCTACAACTGGAACCATAT pLKO.1 769 CDS 100% 10.800 7.560 N Grin1 n/a
10 TRCN0000425861 TGCAAGTGGGCATCTACAATG pLKO_005 1386 CDS 100% 10.800 7.560 N GRIN1 n/a
11 TRCN0000100294 CCCAAATGACAGGAAGATCAT pLKO.1 1420 CDS 100% 4.950 3.465 N Grin1 n/a
12 TRCN0000100292 CTGTCCATACTCAAGTCCCAT pLKO.1 2621 CDS 100% 2.640 1.848 N Grin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008169.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487776 ACGTTGCACTGGCGGACTCGCCTT pLX_317 11.2% 90.7% 99% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000492101 CATCCTGCCAAACATTACTGGTCT pLX_317 7.9% 84.2% 90.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV