Transcript: Mouse NM_008247.3

Mus musculus phospholipid phosphatase 1 (Plpp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Plpp1 (19012)
Length:
1629
CDS:
433..1287

Additional Resources:

NCBI RefSeq record:
NM_008247.3
NBCI Gene record:
Plpp1 (19012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008247.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080878 CCTCGATGTGATTTGCGTGTT pLKO.1 465 CDS 100% 4.050 5.670 N Plpp1 n/a
2 TRCN0000325189 CCTCGATGTGATTTGCGTGTT pLKO_005 465 CDS 100% 4.050 5.670 N Plpp1 n/a
3 TRCN0000080881 GCTATACTGGTTGCTTTGTAT pLKO.1 1150 CDS 100% 5.625 4.500 N Plpp1 n/a
4 TRCN0000325109 GCTATACTGGTTGCTTTGTAT pLKO_005 1150 CDS 100% 5.625 4.500 N Plpp1 n/a
5 TRCN0000080880 GCACTTCTTGGCTATCTGTAA pLKO.1 819 CDS 100% 4.950 3.465 N Plpp1 n/a
6 TRCN0000325190 GCACTTCTTGGCTATCTGTAA pLKO_005 819 CDS 100% 4.950 3.465 N Plpp1 n/a
7 TRCN0000080882 CTTCAAGGACACACATTCTTA pLKO.1 1182 CDS 100% 5.625 3.375 N Plpp1 n/a
8 TRCN0000080879 GCATGCTGTTTGTCGCACTTT pLKO.1 968 CDS 100% 4.950 2.970 N Plpp1 n/a
9 TRCN0000325188 GCATGCTGTTTGTCGCACTTT pLKO_005 968 CDS 100% 4.950 2.970 N Plpp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008247.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.