Transcript: Mouse NM_008266.5

Mus musculus homeobox B1 (Hoxb1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hoxb1 (15407)
Length:
2077
CDS:
70..963

Additional Resources:

NCBI RefSeq record:
NM_008266.5
NBCI Gene record:
Hoxb1 (15407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008266.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070823 CTATGGGCCTTCTCAGTATTA pLKO.1 336 CDS 100% 13.200 18.480 N Hoxb1 n/a
2 TRCN0000070827 CCCACCTAAGACAGCGAAGGT pLKO.1 621 CDS 100% 0.880 1.232 N Hoxb1 n/a
3 TRCN0000235795 GGAAGGAGATGGAAGCTATTT pLKO_005 372 CDS 100% 13.200 9.240 N Hoxb1 n/a
4 TRCN0000235793 CACCCTGGAGCTCAATGAAAC pLKO_005 771 CDS 100% 10.800 7.560 N Hoxb1 n/a
5 TRCN0000235792 CCAGTTCTCTCGAAGACTTTC pLKO_005 1001 3UTR 100% 10.800 7.560 N Hoxb1 n/a
6 TRCN0000235796 GAATTGAACTTCCTAAGTAAC pLKO_005 962 CDS 100% 10.800 7.560 N Hoxb1 n/a
7 TRCN0000235794 GAATCGCCTTGCTCGTCAGAA pLKO_005 550 CDS 100% 4.950 3.465 N Hoxb1 n/a
8 TRCN0000070824 CTTCGACTGGATGAAGGTCAA pLKO.1 594 CDS 100% 4.050 2.835 N Hoxb1 n/a
9 TRCN0000070825 GCTCAATGAAACGCAGGTGAA pLKO.1 780 CDS 100% 4.050 2.835 N Hoxb1 n/a
10 TRCN0000070826 CGGAAGGAGATGGAAGCTATT pLKO.1 371 CDS 100% 10.800 6.480 N Hoxb1 n/a
11 TRCN0000240233 ACGCAGGTGAAGATCTGGTTC pLKO_005 790 CDS 100% 4.050 2.025 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008266.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.