Transcript: Mouse NM_008278.2

Mus musculus hydroxyprostaglandin dehydrogenase 15 (NAD) (Hpgd), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Hpgd (15446)
Length:
1719
CDS:
69..878

Additional Resources:

NCBI RefSeq record:
NM_008278.2
NBCI Gene record:
Hpgd (15446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041541 CCAAGGTAGCATTGGTGGATT pLKO.1 157 CDS 100% 4.950 3.960 N Hpgd n/a
2 TRCN0000041539 CCCATCCTTGAATCCATTGAA pLKO.1 633 CDS 100% 5.625 3.938 N Hpgd n/a
3 TRCN0000041538 GCAGGCGTGAACAATGAGAAA pLKO.1 342 CDS 100% 4.950 3.465 N Hpgd n/a
4 TRCN0000041542 CGCAGCAACCTGTTTATTGTT pLKO.1 505 CDS 100% 5.625 3.938 N Hpgd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008278.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00782 pDONR223 100% 86.8% 88.1% None (many diffs) n/a
2 ccsbBroad304_00782 pLX_304 0% 86.8% 88.1% V5 (many diffs) n/a
3 TRCN0000468979 TTAATATCGTTATTTACTAACGCA pLX_317 52.6% 86.8% 88.1% V5 (many diffs) n/a
Download CSV