Transcript: Mouse NM_008308.4

Mus musculus 5-hydroxytryptamine (serotonin) receptor 1A (Htr1a), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Htr1a (15550)
Length:
4441
CDS:
562..1827

Additional Resources:

NCBI RefSeq record:
NM_008308.4
NBCI Gene record:
Htr1a (15550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008308.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221272 CGACCCTATAGACTACGTGAA pLKO.1 978 CDS 100% 4.050 5.670 N Htr1a n/a
2 TRCN0000221275 CCCTGCTCAACCCAGTTATTT pLKO.1 1739 CDS 100% 15.000 10.500 N Htr1a n/a
3 TRCN0000221271 CCCTTCCTGTTCACTCAATAT pLKO.1 1912 3UTR 100% 13.200 9.240 N Htr1a n/a
4 TRCN0000256444 CTAAGTGAGAGGGCATCAAAT pLKO_005 3457 3UTR 100% 13.200 9.240 N Htr1a n/a
5 TRCN0000265813 GTCACCTGTGACCTGTTTATC pLKO_005 880 CDS 100% 13.200 9.240 N Htr1a n/a
6 TRCN0000256442 TCTCGCTCACTTGGCTCATTG pLKO_005 1031 CDS 100% 10.800 7.560 N Htr1a n/a
7 TRCN0000256441 TTCAGAATGTTGCCAACTATC pLKO_005 761 CDS 100% 10.800 7.560 N Htr1a n/a
8 TRCN0000256443 GAATCCGCAAGACGGTCAAGA pLKO_005 1235 CDS 100% 4.950 3.465 N Htr1a n/a
9 TRCN0000221274 GTACACCATCTACTCCACTTT pLKO.1 1143 CDS 100% 4.950 3.465 N Htr1a n/a
10 TRCN0000221273 CCTGAGTTGTTGGGTGCCATA pLKO.1 1693 CDS 100% 4.050 2.835 N Htr1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008308.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488771 AACGCGCTTTCATGGCAAGTGTTC pLX_317 24.9% 85.4% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV