Transcript: Mouse NM_008320.4

Mus musculus interferon regulatory factor 8 (Irf8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Irf8 (15900)
Length:
2855
CDS:
54..1328

Additional Resources:

NCBI RefSeq record:
NM_008320.4
NBCI Gene record:
Irf8 (15900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008320.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235801 TTCCGCATGTTTCCGGATATC pLKO_005 1254 CDS 100% 10.800 15.120 N Irf8 n/a
2 TRCN0000086174 GCCATATAAAGTTTACCGAAT pLKO.1 368 CDS 100% 4.050 5.670 N Irf8 n/a
3 TRCN0000235799 ATCAACAGATCACCGTCTAAG pLKO_005 1309 CDS 100% 10.800 8.640 N Irf8 n/a
4 TRCN0000235797 GGACATTTCTGAGCCATATAA pLKO_005 356 CDS 100% 15.000 10.500 N Irf8 n/a
5 TRCN0000235798 TGGCCGCAACCTGTGATTAAA pLKO_005 1509 3UTR 100% 15.000 10.500 N Irf8 n/a
6 TRCN0000086177 TCTGAACAAGAGCCCAGATTT pLKO.1 308 CDS 100% 13.200 9.240 N Irf8 n/a
7 TRCN0000086175 CCATTCAGCTTTCTCCCAGAT pLKO.1 647 CDS 100% 4.050 2.835 N Irf8 n/a
8 TRCN0000086176 GCAGGATTACAATCAGGAGGT pLKO.1 188 CDS 100% 2.160 1.512 N Irf8 n/a
9 TRCN0000235800 ATCCGAGAGCTGCAGCAATTC pLKO_005 1029 CDS 100% 10.800 6.480 N Irf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008320.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00814 pDONR223 100% 85.9% 89.6% None (many diffs) n/a
2 ccsbBroad304_00814 pLX_304 0% 85.9% 89.6% V5 (many diffs) n/a
3 TRCN0000479153 CAGCTTATAAAAGTATTGATGTTG pLX_317 36.5% 85.9% 89.6% V5 (many diffs) n/a
Download CSV