Transcript: Mouse NM_008409.2

Mus musculus integral membrane protein 2A (Itm2a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Itm2a (16431)
Length:
1632
CDS:
145..936

Additional Resources:

NCBI RefSeq record:
NM_008409.2
NBCI Gene record:
Itm2a (16431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112349 GATGTTAGTAACCTTGGTATT pLKO.1 763 CDS 100% 10.800 15.120 N Itm2a n/a
2 TRCN0000112346 GCGGCAATTATTCACGACTTT pLKO.1 559 CDS 100% 4.950 6.930 N Itm2a n/a
3 TRCN0000112347 CCCTCAATACTTCCATTGTTA pLKO.1 635 CDS 100% 5.625 3.938 N Itm2a n/a
4 TRCN0000112348 CCAAAGAATCTGGTGGAACTT pLKO.1 661 CDS 100% 4.950 3.465 N Itm2a n/a
5 TRCN0000112345 GCAGCATGAATGTGTCATCTT pLKO.1 1204 3UTR 100% 4.950 3.465 N Itm2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008409.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02167 pDONR223 100% 89.6% 95% None (many diffs) n/a
2 ccsbBroad304_02167 pLX_304 0% 89.6% 95% V5 (many diffs) n/a
3 TRCN0000468434 GTTTTATTCCGCCCGTACGACTTG pLX_317 59.7% 89.6% 95% V5 (many diffs) n/a
Download CSV