Transcript: Mouse NM_008452.2

Mus musculus Kruppel-like factor 2 (lung) (Klf2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Klf2 (16598)
Length:
1816
CDS:
17..1081

Additional Resources:

NCBI RefSeq record:
NM_008452.2
NBCI Gene record:
Klf2 (16598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081905 CCTAAACAACGTGTTGGACTT pLKO.1 133 CDS 100% 4.050 5.670 N Klf2 n/a
2 TRCN0000288441 CCTAAACAACGTGTTGGACTT pLKO_005 133 CDS 100% 4.050 5.670 N Klf2 n/a
3 TRCN0000081904 CGCCACACATACTTGCAGCTA pLKO.1 820 CDS 100% 2.640 3.696 N Klf2 n/a
4 TRCN0000081907 TGAGGACCTAAACAACGTGTT pLKO.1 127 CDS 100% 4.050 3.240 N Klf2 n/a
5 TRCN0000081903 GCAAACAGACTGCTATTTATT pLKO.1 1148 3UTR 100% 15.000 10.500 N Klf2 n/a
6 TRCN0000295770 GACCGATTGTATTTCTATAAG pLKO_005 1415 3UTR 100% 13.200 9.240 N Klf2 n/a
7 TRCN0000295709 CTTGCACATGAAGCGACACAT pLKO_005 1057 CDS 100% 4.950 3.465 N Klf2 n/a
8 TRCN0000295708 GACCCTTTCAGTGCCACTTGT pLKO_005 1002 CDS 100% 4.950 3.465 N Klf2 n/a
9 TRCN0000081906 CCTTATCATTGCAACTGGGAA pLKO.1 914 CDS 100% 2.640 1.848 N Klf2 n/a
10 TRCN0000295768 CACCAAGAGCTCGCACCTAAA pLKO_005 862 CDS 100% 10.800 6.480 N Klf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487834 CGTCGGGTCTGGAAGATCCCGAAA pLX_317 22.4% 82.2% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV