Transcript: Mouse NM_008567.2

Mus musculus minichromosome maintenance complex component 6 (Mcm6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mcm6 (17219)
Length:
2966
CDS:
141..2606

Additional Resources:

NCBI RefSeq record:
NM_008567.2
NBCI Gene record:
Mcm6 (17219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124143 CCTGGTAGTCAACCCTAACTA pLKO.1 2570 CDS 100% 5.625 4.500 N Mcm6 n/a
2 TRCN0000124140 GCGGACACTATGACAGATCAA pLKO.1 1660 CDS 100% 4.950 3.960 N Mcm6 n/a
3 TRCN0000124139 CTATTGAAGTTGGAACCAAAT pLKO.1 2794 3UTR 100% 10.800 7.560 N Mcm6 n/a
4 TRCN0000019678 CCTACTATACATGGCAATGAT pLKO.1 1206 CDS 100% 5.625 3.938 N MCM6 n/a
5 TRCN0000275721 CCTACTATACATGGCAATGAT pLKO_005 1206 CDS 100% 5.625 3.938 N MCM6 n/a
6 TRCN0000124141 GCTGTCTATACCAGTGGCAAA pLKO.1 1386 CDS 100% 4.050 2.835 N Mcm6 n/a
7 TRCN0000124142 GCTGAGAGCATTAAGAACCAA pLKO.1 1104 CDS 100% 3.000 2.100 N Mcm6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06571 pDONR223 100% 88.2% 95.6% None (many diffs) n/a
2 ccsbBroad304_06571 pLX_304 0% 88.2% 95.6% V5 (many diffs) n/a
3 TRCN0000468693 TTTCCCACGTATCGACGTACTCCT pLX_317 16.1% 88.2% 95.6% V5 (many diffs) n/a
Download CSV